Literatur Lin, H. und Spradling, A. C., 1997. A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development. 124, 2463-76. Liu, P. Z. und Kaufman, T. C., 2004. hunchback is required for suppression of abdominal identity, and for proper germband growth and segmentation in the intermediate germband insect Oncopeltus fasciatus. Development. 131, 1515-27. Lopez-Schier, H., 2003. The polarisation of the anteroposterior axis in Drosophila. Bioessays. 25, 781-91. Lorenzen, M. D., Berghammer, A. J., Brown, S. J., Denell, R. E., Klingler, M. und Beeman, R. W., 2003. piggyBac-mediated germline transformation in the beetle Tribolium castaneum. Insect Mol Biol. 12, 433-40. Lorenzen, M. D., Brown, S. J., Denell, R. E. und Beeman, R. W., 2002. Cloning and characterization of the Tribolium castaneum eye-color genes encoding tryptophan oxygenase and kynurenine 3-monooxygenase. Genetics. 160, 225-34. Lorenzen, M. D., Doyungan, Z., Savard, J., Snow, K., Crumly, L. R., Shippy, T. D., Stuart, J. J., Brown, S. J. und Beeman, R. W., 2005. Genetic linkage maps of the red flour beetle, Tribolium castaneum, based on bacterial artificial chromosomes and expressed sequence tags. Genetics. 170, 741-7. Lorenzen, M. D., Kimzey, T., Shippy, T. D., Brown, S. J., Denell, R. E. und Beeman, R. W., 2007. piggyBac-based insertional mutagenesis in Tribolium castaneum using donor/helper hybrids. Insect Mol Biol. 16, 265-75. Lynch, J. A., Olesnicky, E. C. und Desplan, C., 2006. Regulation and function of tailless in the long germ wasp Nasonia vitripennis. Dev Genes Evol. 216, 493-8. Ma, Y., Creanga, A., Lum, L. und Beachy, P. A., 2006. Prevalence of off-target effects in Drosophila RNA interference screens. Nature. 443, 359-63. MacArthur, H., Bubunenko, M., Houston, D. W. und King, M. L., 1999. Xcat2 RNA is a translationally sequestered germ plasm component in Xenopus. Mech Dev. 84, 75-88. Macdonald, P. M., 1992. The Drosophila pumilio gene: an unusually long transcription unit and an unusual protein. Development. 114, 221-32. Macdonald, P. M., Ingham, P. und Struhl, G., 1986. Isolation, structure, and expression of even-skipped: a second pair-rule gene of Drosophila containing a homeo box. Cell. 47, 721-34. Macdonald, P. M. und Struhl, G., 1986. A molecular gradient in early Drosophila embryos and its role in specifying the body pattern. Nature. 324, 537-45. Maderspacher, F., Bucher, G. und Klingler, M., 1998. Pair-rule and gap gene mutants in the flour beetle Tribolium castaneum. Dev Genes Evol. 208, 558-68. Manoukian, A. S. und Krause, H. M., 1992. Concentration-dependent activities of the evenskipped protein in Drosophila embryos. Genes Dev. 6, 1740-51. Margolis, J. S., Borowsky, M. L., Steingrimsson, E., Shim, C. W., Lengyel, J. A. und Posakony, J. W., 1995. Posterior stripe expression of hunchback is driven from two promoters by a common enhancer element. Development. 121, 3067-77. Marques-Souza, H., Aranda, M. und Tautz, D., 2008. Delimiting the conserved features of hunchback function for the trunk organization of insects. Development. 135, 881-8. Martinez-Arias, A., Baker, N. E. und Ingham, P. W., 1988. Role of segment polarity genes in the definition and maintenance of cell states in the Drosophila embryo. Development. 103, 157-70. Martinez-Arias, A. und Lawrence, P. A., 1985. Parasegments and compartments in the Drosophila embryo. Nature. 313, 639-42. Masuda, N., Ohnishi, T., Kawamoto, S., Monden, M. und Okubo, K., 1999. Analysis of chemical modification of RNA from formalin-fixed samples and optimization of molecular biology applications for such samples. Nucleic Acids Res. 27, 4436-43. Mazzalupo, S. und Cooley, L., 2006. Illuminating the role of caspases during Drosophila oogenesis. Cell Death Differ. 13, 1950-9. McGregor, A. P., Pechmann, M., Schwager, E. E. und Damen, W. G., 2009. An ancestral regulatory network for posterior development in arthropods. Commun Integr Biol. 2, 174- 6. 254
Literatur Mee, C. J., Pym, E. C., Moffat, K. G. und Baines, R. A., 2004. Regulation of neuronal excitability through pumilio-dependent control of a sodium channel gene. J Neurosci. 24, 8695- 703. Meister, G. und Tuschl, T., 2004. Mechanisms of gene silencing by double-stranded RNA. Nature. 431, 343-9. Menon, K. P., Andrews, S., Murthy, M., Gavis, E. R. und Zinn, K., 2009. The translational repressors Nanos and Pumilio have divergent effects on presynaptic terminal growth and postsynaptic glutamate receptor subunit composition. J Neurosci. 29, 5558-72. Menon, K. P., Sanyal, S., Habara, Y., Sanchez, R., Wharton, R. P., Ramaswami, M. und Zinn, K., 2004. The translational repressor Pumilio regulates presynaptic morphology and controls postsynaptic accumulation of translation factor eIF-4E. Neuron. 44, 663-76. Miklos, G. L. und Rubin, G. M., 1996. The role of the genome project in determining gene function: insights from model organisms. Cell. 86, 521-9. Miller, S. C., Brown, S. J. und Tomoyasu, Y., 2008. Larval RNAi in Drosophila? Dev Genes Evol. 218, 505-10. Mische, S., He, Y., Ma, L., Li, M., Serr, M. und Hays, T. S., 2008. Dynein light intermediate chain: an essential subunit that contributes to spindle checkpoint inactivation. Mol Biol Cell. 19, 4918-29. Missios, S., Davidson, H. C., Linder, D., Mortimer, L., Okobi, A. O. und Doctor, J. S., 2000. Characterization of cuticular proteins in the red flour beetle, Tribolium castaneum. Insect Biochem Mol Biol. 30, 47-56. Mito, T. und Noji, S., 2006. Evolution of developmental systems underlying segmented body plans of bilaterian animals: insights from studies of segmentation in a cricket. Paleontological Research. 10, 337-344. Mochizuki, K., Sano, H., Kobayashi, S., Nishimiya-Fujisawa, C. und Fujisawa, T., 2000. Expression and evolutionary conservation of nanos-related genes in Hydra. Dev Genes Evol. 210, 591-602. Moczek, A. P., 2007. Pupal remodeling and the evolution and development of alternative male morphologies in horned beetles. BMC Evolutionary Biology. 7, Article No.: 151. Moore, F. L., Jaruzelska, J., Fox, M. S., Urano, J., Firpo, M. T., Turek, P. J., Dorfman, D. M. und Pera, R. A., 2003. Human Pumilio-2 is expressed in embryonic stem cells and germ cells and interacts with DAZ (Deleted in AZoospermia) and DAZ-like proteins. Proc Natl Acad Sci U S A. 100, 538-43. Morgan, T. H., 1911. The Origin of Five Mutations in Eye Color in Drosophila and Their Modes of Inheritance. Science. 33, 534-537. Morgan, T. H., 1915. Localization of the Hereditary Material in the Germ Cells. Proc Natl Acad Sci U S A. 1, 420-9. Morris, K., Lorenzen, M. D., Hiromasa, Y., Tomich, J. M., Oppert, C., Elpidina, E. N., Vinokurov, K., Jurat-Fuentes, J. L., Fabrick, J. und Oppert, B., 2009. Tribolium castaneum larval gut transcriptome and proteome: A resource for the study of the coleopteran gut. J Proteome Res. 8, 3889-98. Mosquera, L., Forristall, C., Zhou, Y. und King, M. L., 1993. A mRNA localized to the vegetal cortex of Xenopus oocytes encodes a protein with a nanos-like zinc finger domain. Development. 117, 377-86. Moussian, B. und Roth, S., 2005. Dorsoventral axis formation in the Drosophila embryo-shaping and transducing a morphogen gradient. Curr Biol. 15, R887-99. Muller, H. J., 1927. Artificial Transmutation of the Gene. Science. 66, 84-87. Muraro, N. I., Weston, A. J., Gerber, A. P., Luschnig, S., Moffat, K. G. und Baines, R. A., 2008. Pumilio binds para mRNA and requires Nanos and Brat to regulate sodium current in Drosophila motoneurons. J Neurosci. 28, 2099-109. Murata, Y. und Wharton, R. P., 1995. Binding of pumilio to maternal hunchback mRNA is required for posterior patterning in Drosophila embryos. Cell. 80, 747-56. Nagy, L. M. und Carroll, S., 1994. Conservation of wingless patterning functions in the shortgerm embryos of Tribolium castaneum. Nature. 367, 460-3. Nakahata, S., Katsu, Y., Mita, K., Inoue, K., Nagahama, Y. und Yamashita, M., 2001. Biochemical identification of Xenopus Pumilio as a sequence-specific cyclin B1 mRNA- 255
- Seite 1 und 2:
Die Funktion von Genen der posterio
- Seite 3:
Danke! Obwohl als letztes verfasst,
- Seite 6 und 7:
Inhaltsverzeichnis 2.4.1. Die Segme
- Seite 8 und 9:
Inhaltsverzeichnis 3.1.2. Die Auswe
- Seite 10 und 11:
Summary 2 Thus, I could show that a
- Seite 12 und 13:
Zusammenfassung praktischen Durchf
- Seite 14 und 15:
Abbildungsverzeichnis Abb. 24: Sche
- Seite 16 und 17:
Abkürzungen Abkürzungen 8 AS: Ami
- Seite 19 und 20:
Allgemeine Einleitung Allgemeine Ei
- Seite 21 und 22:
Allgemeine Einleitung Tiere, hervor
- Seite 23 und 24:
I. Kapitel: I. 1. Einleitung Die Fu
- Seite 25 und 26:
I. 1. Einleitung 3; Davis und Patel
- Seite 27 und 28:
I. 1. Einleitung 1.2. Drosophila me
- Seite 29 und 30:
I. 1. Einleitung Butler, 1988). Int
- Seite 31 und 32:
I. 1. Einleitung zur Phosphorylieru
- Seite 33 und 34:
I. 1. Einleitung Gene ist in Tribol
- Seite 35 und 36:
I. 1. Einleitung Die frühe Regulat
- Seite 37 und 38:
I. 1. Einleitung wahrscheinlich üb
- Seite 39 und 40:
I. 1. Einleitung wie in Vertebraten
- Seite 41 und 42:
I. 1. Einleitung und Wharton, 1999)
- Seite 43 und 44:
I. 1. Einleitung des nanos-Verlusts
- Seite 45 und 46:
I. 1. Einleitung Außerdem zeigen n
- Seite 47 und 48:
1.5. Ziele des ersten Kapitels der
- Seite 49 und 50:
2. Ergebnisse I. 2. Ergebnisse 2.1.
- Seite 51 und 52:
I. 2. Ergebnisse Abb. 6: Sequenzver
- Seite 53 und 54:
I. 2. Ergebnisse Domäne vermittelt
- Seite 55 und 56:
2.2.2. nanos-Expression ist nur in
- Seite 57 und 58:
I. 2. Ergebnisse 2.3. pRNAi für na
- Seite 59 und 60:
I. 2. Ergebnisse einerseits, dass d
- Seite 61 und 62:
I. 2. Ergebnisse des Kopfes. Außer
- Seite 63 und 64:
I. 2. Ergebnisse Doppel-RNAi in ver
- Seite 65 und 66:
I. 2. Ergebnisse 2.4. Frühembryona
- Seite 67 und 68:
I. 2. Ergebnisse nächst ist zu beo
- Seite 69 und 70:
I. 2. Ergebnisse 61
- Seite 71 und 72:
I. 2. Ergebnisse Domäne. Diese ble
- Seite 73 und 74:
I. 2. Ergebnisse 65
- Seite 75 und 76:
I. 2. Ergebnisse terminaler Zielgen
- Seite 77 und 78:
I. 2. Ergebnisse Tatsächlich fehle
- Seite 79 und 80:
I. 2. Ergebnisse Abb. 15: nos/pum-R
- Seite 81 und 82:
I. 2. Ergebnisse Expression auf die
- Seite 83 und 84:
I. 2. Ergebnisse 2.7. Die Beteiligu
- Seite 85 und 86:
2.7.1. Tribolium brain-tumor I. 2.
- Seite 87 und 88:
I. 2. Ergebnisse 2.7.3. brat-RNAi f
- Seite 89 und 90:
I. 2. Ergebnisse kulas somit interm
- Seite 91 und 92:
Abb. 19: brain-tumor-RNAi führt zu
- Seite 93 und 94:
I. 2. Ergebnisse Keimbahn in Verbin
- Seite 95 und 96:
I. 2. Ergebnisse 2.8.3. pumilio spi
- Seite 97 und 98:
I. 2. Ergebnisse Präpuppe, deren M
- Seite 99 und 100:
3. Diskussion I. 3. Diskussion 3.1.
- Seite 101 und 102:
I. 3. Diskussion mann, 1998; Asaoka
- Seite 103 und 104:
I. 3. Diskussion leider nicht gepr
- Seite 105 und 106:
I. 3. Diskussion Möglicherweise ve
- Seite 107 und 108:
I. 3. Diskussion Marques-Souza et a
- Seite 109 und 110:
I. 3. Diskussion der antennalen Seg
- Seite 111 und 112:
I. 3. Diskussion Effekt, der erst i
- Seite 113 und 114:
I. 3. Diskussion Netzwerk, das zur
- Seite 115 und 116:
I. 3. Diskussion gerufene Vernetzun
- Seite 117 und 118:
I. 3. Diskussion Natürlich gibt es
- Seite 119 und 120:
I. 3. Diskussion 3.4. Das Zusammens
- Seite 121 und 122:
I. 3. Diskussion sion als Substrat
- Seite 123 und 124:
I. 3. Diskussion ren gt-Domäne üb
- Seite 125 und 126:
I. 3. Diskussion Außerdem hat otd-
- Seite 127 und 128:
I. 3. Diskussion on eines von Fakto
- Seite 129 und 130:
I. 3. Diskussion jeweiligen ersten
- Seite 131 und 132:
4. Material und Methoden I. 4. Mate
- Seite 133 und 134:
4.2.1. in situ Hybridisierung I. 4.
- Seite 135 und 136:
I. 4. Material und Methoden ohne Bl
- Seite 137:
Tab. 6: Primer für dsRNA Matrize I
- Seite 140 und 141:
II. 1. Einleitung 132 In Anlehnung
- Seite 142 und 143:
II. 1. Einleitung Entwicklung. Dabe
- Seite 144 und 145:
II. 1. Einleitung 1.3. RNAi-Screens
- Seite 146 und 147:
II. 1. Einleitung Serie zu beobacht
- Seite 148 und 149:
II. 1. Einleitung 140 schen Fragest
- Seite 150 und 151:
II. 1. Einleitung Augen und im zent
- Seite 152 und 153:
II. 1. Einleitung 1.4.3. Die iBeetl
- Seite 154 und 155:
II. 1. Einleitung sophila wegen tec
- Seite 156 und 157:
II. 1. Einleitung 1.5. Ziele des zw
- Seite 158 und 159:
II. 2. Ergebnisse nale Musterbildun
- Seite 160 und 161:
II. 2. Ergebnisse 152 Im nächsten
- Seite 162 und 163:
II. 2. Ergebnisse bei 30°C inkubie
- Seite 164 und 165:
II. 2. Ergebnisse 1999a) 156 Auch d
- Seite 166 und 167:
II. 2. Ergebnisse lichst effektiv z
- Seite 168 und 169:
II. 2. Ergebnisse 160
- Seite 170 und 171:
II. 2. Ergebnisse 162
- Seite 172 und 173:
II. 2. Ergebnisse Abb. 29: Arbeitsp
- Seite 174 und 175:
II. 2. Ergebnisse Ergebnisse der Po
- Seite 176 und 177:
II. 2. Ergebnisse von RNAi-Effekten
- Seite 178 und 179:
II. 2. Ergebnisse 2.3. Es konnten f
- Seite 180 und 181:
II. 2. Ergebnisse Abb. 32: Zusammen
- Seite 182 und 183:
II. 2. Ergebnisse Abb. 33: Defekte
- Seite 184 und 185:
II. 2. Ergebnisse zu trennen. So k
- Seite 186 und 187:
II. 2. Ergebnisse 2.3.2. Defekte w
- Seite 188 und 189:
II. 2. Ergebnisse Abb. 35: Morpholo
- Seite 190 und 191:
II. 2. Ergebnisse diesen Phänotype
- Seite 192 und 193:
II. 2. Ergebnisse 184
- Seite 194 und 195:
II. 2. Ergebnisse Abb. 37: In adult
- Seite 196 und 197:
II. 2. Ergebnisse Abb. 38: Bisher u
- Seite 198 und 199:
II. 3. Diskussion des ersten Jahres
- Seite 200 und 201:
II. 3. Diskussion analysiert werden
- Seite 202 und 203:
II. 3. Diskussion Meinung, dass der
- Seite 204 und 205:
II. 3. Diskussion jeweils zu Beginn
- Seite 206 und 207:
II. 3. Diskussion nach den gleichen
- Seite 208 und 209:
II. 3. Diskussion in Tribolium, nic
- Seite 210 und 211:
II. 3. Diskussion 1980). Bei der Ka
- Seite 212 und 213: II. 3. Diskussion phänotypische Hi
- Seite 214 und 215: II. 3. Diskussion 3.2.6. iBeetle ha
- Seite 216 und 217: II. 3. Diskussion Prozesse der Inse
- Seite 218 und 219: II. 4. Material und Methoden Phenol
- Seite 220 und 221: II. 4. Material und Methoden pigmen
- Seite 222 und 223: II. 4. Material und Methoden 214 Em
- Seite 224 und 225: II. 4. Material und Methoden bei de
- Seite 226 und 227: II. 4. Material und Methoden 218 Ti
- Seite 229 und 230: Allgemeine Diskussion Allgemeine Di
- Seite 231: Allgemeine Diskussion und Achsendet
- Seite 234 und 235: Anhang ACCCATCCGTACGGCTGCCGGGTCATTC
- Seite 236 und 237: Anhang 2. Ergänzende Ergebnisse zu
- Seite 238 und 239: Anhang 3. Zeitaufwand der iBeetle-A
- Seite 240 und 241: Anhang 5. Zusammenfassung der Ergeb
- Seite 242 und 243: 234 134 900 14 similar to D123 (cdc
- Seite 244 und 245: 236 77 1500 57 gene without homolog
- Seite 246 und 247: 238 43 1000 99 similar to Rab-prote
- Seite 248 und 249: Anhang gemischt embryonal letal von
- Seite 250 und 251: Literatur Literatur Abdel-Latief, M
- Seite 252 und 253: Literatur Bernstein, D., Hook, B.,
- Seite 254 und 255: Literatur Ciglar, L. und Furlong, E
- Seite 256 und 257: Literatur Falciani, F., Hausdorf, B
- Seite 258 und 259: Literatur Gutjahr, T., Vanario-Alon
- Seite 260 und 261: Literatur Kiger, A. A., Baum, B., J
- Seite 264 und 265: Literatur binding protein that phys
- Seite 266 und 267: Literatur Riddiford, L. M., Hiruma,
- Seite 268 und 269: Literatur Schüpbach, T. und Wiesch
- Seite 270 und 271: Literatur Tomoyasu, Y., Miller, S.
- Seite 272: Literatur Zhang, X. D. und Heyse, J