Literatur Gutjahr, T., Vanario-Alonso, C. E., Pick, L. und Noll, M., 1994. Multiple regulatory elements direct the complex expression pattern of the Drosophila segmentation gene paired. Mech Dev. 48, 119-28. Handberg-Thorsager, M. und Salo, E., 2007. The planarian nanos-like gene Smednos is expressed in germline and eye precursor cells during development and regeneration. Dev Genes Evol. 217, 403-11. Handel, K., Basal, A., Fan, X. und Roth, S., 2005. Tribolium castaneum twist: gastrulation and mesoderm formation in a short-germ beetle. Dev Genes Evol. 215, 13-31. Handel, K., Grunfelder, C. G., Roth, S. und Sander, K., 2000. Tribolium embryogenesis: a SEM study of cell shapes and movements from blastoderm to serosal closure. Dev Genes Evol. 210, 167-79. Handler, A. M. und Beeman, R. W., 2003. United States Department of Agriculture - Agricultural Research Service: advances in the molecular genetic analysis of insects and their application to pest management. Pest Management Science. 59, 728-735. Hankins, G. R., Analysis of a Drosophilia neuroblastoma gene, Thesis (Ph D ), University of Virginia Hansen, D., Wilson-Berry, L., Dang, T. und Schedl, T., 2004. Control of the proliferation versus meiotic development decision in the C. elegans germline through regulation of GLD-1 protein accumulation. Development. 131, 93-104. Haraguchi, S., Tsuda, M., Kitajima, S., Sasaoka, Y., Nomura-Kitabayashid, A., Kurokawa, K. und Saga, Y., 2003. nanos1: a mouse nanos gene expressed in the central nervous system is dispensable for normal development. Mech Dev. 120, 721-31. Harding, K. und Levine, M., 1988. Gap genes define the limits of antennapedia and bithorax gene expression during early development in Drosophila. EMBO J. 7, 205-14. Harding, K., Rushlow, C., Doyle, H. J., Hoey, T. und Levine, M., 1986. Cross-regulatory interactions among pair-rule genes in Drosophila. Science. 233, 953-9. Hartenstein, V., 1993. Atlas of Drosophila development. Atlas of Drosophila development. v+57p. Hartmann, C., Taubert, H., Jäckle, H. und Pankratz, M. J., 1994. A two-step mode of stripe formation in the Drosophila blastoderm requires interactions among primary pair rule genes. Mech Dev. 45, 3-13. Hashimoto, Y., Kondo, T. und Kageyama, Y., 2008. Lilliputians get into the limelight: novel class of small peptide genes in morphogenesis. Dev Growth Differ. 50 Suppl 1, S269-76. Hayashi, Y., Hayashi, M. und Kobayashi, S., 2004. Nanos suppresses somatic cell fate in Drosophila germ line. Proc Natl Acad Sci U S A. 101, 10338-42. Heming, B. S., 2003. Insect Development and Evolution. Cornell University Press, Ithaca. Ho, K., Dunin-Borkowski, O. M. und Akam, M., 1997. Cellularization in locust embryos occurs before blastoderm formation. Development. 124, 2761-8. Hoek, M., Zanders, T. und Cross, G. A., 2002a. Trypanosoma brucei expression-siteassociated-gene-8 protein interacts with a Pumilio family protein. Mol Biochem Parasitol. 120, 269-83. Hoek, M., Zanders, T. und Cross, G. A. M., 2002b. Trypanosoma brucei expression-siteassociated-gene-8 protein interacts with a Pumilio family protein. Molecular and Biochemical Parasitology. 120, 269-283. Holen, T., Amarzguioui, M., Wiiger, M. T., Babaie, E. und Prydz, H., 2002. Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor. Nucleic Acids Res. 30, 1757-66. Honeybee Genome Sequencing Consortium, 2006. Insights into social insects from the genome of the honeybee Apis mellifera. Nature. 443, 931-49. Horn, C. und Wimmer, E. A., 2000. A versatile vector set for animal transgenesis. Dev Genes Evol. 210, 630-7. Horne-Badovinac, S. und Bilder, D., 2005. Mass transit: epithelial morphogenesis in the Drosophila egg chamber. Dev Dyn. 232, 559-74. Hughes, C. L. und Kaufman, T. C., 2002. Hox genes and the evolution of the arthropod body plan. Evol Dev. 4, 459-99. 250
Literatur Hülskamp, M., Pfeifle, C. und Tautz, D., 1990. A morphogenetic gradient of hunchback protein organizes the expression of the gap genes Kruppel and knirps in the early Drosophila embryo. Nature. 346, 577-80. Hülskamp, M., Schröder, C., Pfeifle, C., Jäckle, H. und Tautz, D., 1989. Posterior segmentation of the Drosophila embryo in the absence of a maternal posterior organizer gene. Nature. 338, 629-32. Hülskamp, M. und Tautz, D., 1991. Gap genes and gradients--the logic behind the gaps. Bioessays. 13, 261-8. Ingham, P. und Gergen, P., 1988. INTERACTIONS BETWEEN THE PAIR-RULE GENES RUNT, HAIRY, EVEN-SKIPPED AND FUSHI-TARAZU AND THE ESTABLISHMENT OF PERIODIC PATTERN IN THE DROSOPHILA EMBRYO. Development. 104, 51-60. Ingham, P. W., Baker, N. E. und Martinez-Arias, A., 1988. Regulation of segment polarity genes in the Drosophila blastoderm by fushi tarazu and even skipped. Nature. 331, 73-5. Ingham, P. W. und Martinez-Arias, A., 1986. The correct activation of Antennapedia and bithorax complex genes requires the fushi tarazu gene. Nature. 324, 592-7. Ip, Y. T., Park, R. E., Kosman, D., Yazdanbakhsh, K. und Levine, M., 1992. dorsal-twist interactions establish snail expression in the presumptive mesoderm of the Drosophila embryo. Genes Dev. 6, 1518-30. Irish, V., Lehmann, R. und Akam, M., 1989a. The Drosophila posterior-group gene nanos functions by repressing hunchback activity. Nature. 338, 646-8. Irish, V. F., Martinez-Arias, A. und Akam, M., 1989b. Spatial regulation of the Antennapedia and Ultrabithorax homeotic genes during Drosophila early development. EMBO J. 8, 1527-37. Jack, T. und McGinnis, W., 1990. Establishment of the Deformed expression stripe requires the combinatorial action of coordinate, gap and pair-rule proteins. EMBO J. 9, 1187-98. Jain, R. A. und Gavis, E. R., 2008. The Drosophila hnRNP M homolog Rumpelstiltskin regulates nanos mRNA localization. Development. 135, 973-82. Jaruzelska, J., Kotecki, M., Kusz, K., Spik, A., Firpo, M. und Reijo Pera, R. A., 2003. Conservation of a Pumilio-Nanos complex from Drosophila germ plasm to human germ cells. Dev Genes Evol. 213, 120-6. Jia, H., Liu, Y., Yan, W. und Jia, J., 2009. PP4 and PP2A regulate Hedgehog signaling by controlling Smo and Ci phosphorylation. Development. 136, 307-16. Jimenez, G., Guichet, A., Ephrussi, A. und Casanova, J., 2000. Relief of gene repression by torso RTK signaling: role of capicua in Drosophila terminal and dorsoventral patterning. Genes Dev. 14, 224-31. Jorgensen, E. M. und Mango, S. E., 2002. The art and design of genetic screens: Caenorhabditis elegans. Nature Reviews Genetics. 3, 356-369. Juhn, J., Marinotti, O., Calvo, E. und James, A. A., 2008. Gene structure and expression of nanos (nos) and oskar (osk) orthologues of the vector mosquito, Culex quinquefasciatus. Insect Mol Biol. 17, 545-52. Jürgens, G., Lehmann, R., Schardin, M. und Nüsslein-Volhard, C., 1986. Segmental organization of the head in the embryo of Drosophila melanogaster - a blastoderm fate map of the cuticle structures of the larval head. Wilhelm Roux's Archives of Developmental Biology. 195, 359-377. Kadyrova, L. Y., Habara, Y., Lee, T. H. und Wharton, R. P., 2007. Translational control of maternal Cyclin B mRNA by Nanos in the Drosophila germline. Development. 134, 1519- 27. Kang, D., Pilon, M. und Weisblat, D. A., 2002. Maternal and zygotic expression of a nanosclass gene in the leech Helobdella robusta: primordial germ cells arise from segmental mesoderm. Dev Biol. 245, 28-41. Kaye, J. A., Rose, N. C., Goldsworthy, B., Goga, A. und L'Etoile, N. D., 2009. A 3'UTR pumilio-binding element directs translational activation in olfactory sensory neurons. Neuron. 61, 57-70. Kennerdell, J. R. und Carthew, R. W., 1998. Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell. 95, 1017-26. 251
- Seite 1 und 2:
Die Funktion von Genen der posterio
- Seite 3:
Danke! Obwohl als letztes verfasst,
- Seite 6 und 7:
Inhaltsverzeichnis 2.4.1. Die Segme
- Seite 8 und 9:
Inhaltsverzeichnis 3.1.2. Die Auswe
- Seite 10 und 11:
Summary 2 Thus, I could show that a
- Seite 12 und 13:
Zusammenfassung praktischen Durchf
- Seite 14 und 15:
Abbildungsverzeichnis Abb. 24: Sche
- Seite 16 und 17:
Abkürzungen Abkürzungen 8 AS: Ami
- Seite 19 und 20:
Allgemeine Einleitung Allgemeine Ei
- Seite 21 und 22:
Allgemeine Einleitung Tiere, hervor
- Seite 23 und 24:
I. Kapitel: I. 1. Einleitung Die Fu
- Seite 25 und 26:
I. 1. Einleitung 3; Davis und Patel
- Seite 27 und 28:
I. 1. Einleitung 1.2. Drosophila me
- Seite 29 und 30:
I. 1. Einleitung Butler, 1988). Int
- Seite 31 und 32:
I. 1. Einleitung zur Phosphorylieru
- Seite 33 und 34:
I. 1. Einleitung Gene ist in Tribol
- Seite 35 und 36:
I. 1. Einleitung Die frühe Regulat
- Seite 37 und 38:
I. 1. Einleitung wahrscheinlich üb
- Seite 39 und 40:
I. 1. Einleitung wie in Vertebraten
- Seite 41 und 42:
I. 1. Einleitung und Wharton, 1999)
- Seite 43 und 44:
I. 1. Einleitung des nanos-Verlusts
- Seite 45 und 46:
I. 1. Einleitung Außerdem zeigen n
- Seite 47 und 48:
1.5. Ziele des ersten Kapitels der
- Seite 49 und 50:
2. Ergebnisse I. 2. Ergebnisse 2.1.
- Seite 51 und 52:
I. 2. Ergebnisse Abb. 6: Sequenzver
- Seite 53 und 54:
I. 2. Ergebnisse Domäne vermittelt
- Seite 55 und 56:
2.2.2. nanos-Expression ist nur in
- Seite 57 und 58:
I. 2. Ergebnisse 2.3. pRNAi für na
- Seite 59 und 60:
I. 2. Ergebnisse einerseits, dass d
- Seite 61 und 62:
I. 2. Ergebnisse des Kopfes. Außer
- Seite 63 und 64:
I. 2. Ergebnisse Doppel-RNAi in ver
- Seite 65 und 66:
I. 2. Ergebnisse 2.4. Frühembryona
- Seite 67 und 68:
I. 2. Ergebnisse nächst ist zu beo
- Seite 69 und 70:
I. 2. Ergebnisse 61
- Seite 71 und 72:
I. 2. Ergebnisse Domäne. Diese ble
- Seite 73 und 74:
I. 2. Ergebnisse 65
- Seite 75 und 76:
I. 2. Ergebnisse terminaler Zielgen
- Seite 77 und 78:
I. 2. Ergebnisse Tatsächlich fehle
- Seite 79 und 80:
I. 2. Ergebnisse Abb. 15: nos/pum-R
- Seite 81 und 82:
I. 2. Ergebnisse Expression auf die
- Seite 83 und 84:
I. 2. Ergebnisse 2.7. Die Beteiligu
- Seite 85 und 86:
2.7.1. Tribolium brain-tumor I. 2.
- Seite 87 und 88:
I. 2. Ergebnisse 2.7.3. brat-RNAi f
- Seite 89 und 90:
I. 2. Ergebnisse kulas somit interm
- Seite 91 und 92:
Abb. 19: brain-tumor-RNAi führt zu
- Seite 93 und 94:
I. 2. Ergebnisse Keimbahn in Verbin
- Seite 95 und 96:
I. 2. Ergebnisse 2.8.3. pumilio spi
- Seite 97 und 98:
I. 2. Ergebnisse Präpuppe, deren M
- Seite 99 und 100:
3. Diskussion I. 3. Diskussion 3.1.
- Seite 101 und 102:
I. 3. Diskussion mann, 1998; Asaoka
- Seite 103 und 104:
I. 3. Diskussion leider nicht gepr
- Seite 105 und 106:
I. 3. Diskussion Möglicherweise ve
- Seite 107 und 108:
I. 3. Diskussion Marques-Souza et a
- Seite 109 und 110:
I. 3. Diskussion der antennalen Seg
- Seite 111 und 112:
I. 3. Diskussion Effekt, der erst i
- Seite 113 und 114:
I. 3. Diskussion Netzwerk, das zur
- Seite 115 und 116:
I. 3. Diskussion gerufene Vernetzun
- Seite 117 und 118:
I. 3. Diskussion Natürlich gibt es
- Seite 119 und 120:
I. 3. Diskussion 3.4. Das Zusammens
- Seite 121 und 122:
I. 3. Diskussion sion als Substrat
- Seite 123 und 124:
I. 3. Diskussion ren gt-Domäne üb
- Seite 125 und 126:
I. 3. Diskussion Außerdem hat otd-
- Seite 127 und 128:
I. 3. Diskussion on eines von Fakto
- Seite 129 und 130:
I. 3. Diskussion jeweiligen ersten
- Seite 131 und 132:
4. Material und Methoden I. 4. Mate
- Seite 133 und 134:
4.2.1. in situ Hybridisierung I. 4.
- Seite 135 und 136:
I. 4. Material und Methoden ohne Bl
- Seite 137:
Tab. 6: Primer für dsRNA Matrize I
- Seite 140 und 141:
II. 1. Einleitung 132 In Anlehnung
- Seite 142 und 143:
II. 1. Einleitung Entwicklung. Dabe
- Seite 144 und 145:
II. 1. Einleitung 1.3. RNAi-Screens
- Seite 146 und 147:
II. 1. Einleitung Serie zu beobacht
- Seite 148 und 149:
II. 1. Einleitung 140 schen Fragest
- Seite 150 und 151:
II. 1. Einleitung Augen und im zent
- Seite 152 und 153:
II. 1. Einleitung 1.4.3. Die iBeetl
- Seite 154 und 155:
II. 1. Einleitung sophila wegen tec
- Seite 156 und 157:
II. 1. Einleitung 1.5. Ziele des zw
- Seite 158 und 159:
II. 2. Ergebnisse nale Musterbildun
- Seite 160 und 161:
II. 2. Ergebnisse 152 Im nächsten
- Seite 162 und 163:
II. 2. Ergebnisse bei 30°C inkubie
- Seite 164 und 165:
II. 2. Ergebnisse 1999a) 156 Auch d
- Seite 166 und 167:
II. 2. Ergebnisse lichst effektiv z
- Seite 168 und 169:
II. 2. Ergebnisse 160
- Seite 170 und 171:
II. 2. Ergebnisse 162
- Seite 172 und 173:
II. 2. Ergebnisse Abb. 29: Arbeitsp
- Seite 174 und 175:
II. 2. Ergebnisse Ergebnisse der Po
- Seite 176 und 177:
II. 2. Ergebnisse von RNAi-Effekten
- Seite 178 und 179:
II. 2. Ergebnisse 2.3. Es konnten f
- Seite 180 und 181:
II. 2. Ergebnisse Abb. 32: Zusammen
- Seite 182 und 183:
II. 2. Ergebnisse Abb. 33: Defekte
- Seite 184 und 185:
II. 2. Ergebnisse zu trennen. So k
- Seite 186 und 187:
II. 2. Ergebnisse 2.3.2. Defekte w
- Seite 188 und 189:
II. 2. Ergebnisse Abb. 35: Morpholo
- Seite 190 und 191:
II. 2. Ergebnisse diesen Phänotype
- Seite 192 und 193:
II. 2. Ergebnisse 184
- Seite 194 und 195:
II. 2. Ergebnisse Abb. 37: In adult
- Seite 196 und 197:
II. 2. Ergebnisse Abb. 38: Bisher u
- Seite 198 und 199:
II. 3. Diskussion des ersten Jahres
- Seite 200 und 201:
II. 3. Diskussion analysiert werden
- Seite 202 und 203:
II. 3. Diskussion Meinung, dass der
- Seite 204 und 205:
II. 3. Diskussion jeweils zu Beginn
- Seite 206 und 207:
II. 3. Diskussion nach den gleichen
- Seite 208 und 209: II. 3. Diskussion in Tribolium, nic
- Seite 210 und 211: II. 3. Diskussion 1980). Bei der Ka
- Seite 212 und 213: II. 3. Diskussion phänotypische Hi
- Seite 214 und 215: II. 3. Diskussion 3.2.6. iBeetle ha
- Seite 216 und 217: II. 3. Diskussion Prozesse der Inse
- Seite 218 und 219: II. 4. Material und Methoden Phenol
- Seite 220 und 221: II. 4. Material und Methoden pigmen
- Seite 222 und 223: II. 4. Material und Methoden 214 Em
- Seite 224 und 225: II. 4. Material und Methoden bei de
- Seite 226 und 227: II. 4. Material und Methoden 218 Ti
- Seite 229 und 230: Allgemeine Diskussion Allgemeine Di
- Seite 231: Allgemeine Diskussion und Achsendet
- Seite 234 und 235: Anhang ACCCATCCGTACGGCTGCCGGGTCATTC
- Seite 236 und 237: Anhang 2. Ergänzende Ergebnisse zu
- Seite 238 und 239: Anhang 3. Zeitaufwand der iBeetle-A
- Seite 240 und 241: Anhang 5. Zusammenfassung der Ergeb
- Seite 242 und 243: 234 134 900 14 similar to D123 (cdc
- Seite 244 und 245: 236 77 1500 57 gene without homolog
- Seite 246 und 247: 238 43 1000 99 similar to Rab-prote
- Seite 248 und 249: Anhang gemischt embryonal letal von
- Seite 250 und 251: Literatur Literatur Abdel-Latief, M
- Seite 252 und 253: Literatur Bernstein, D., Hook, B.,
- Seite 254 und 255: Literatur Ciglar, L. und Furlong, E
- Seite 256 und 257: Literatur Falciani, F., Hausdorf, B
- Seite 260 und 261: Literatur Kiger, A. A., Baum, B., J
- Seite 262 und 263: Literatur Lin, H. und Spradling, A.
- Seite 264 und 265: Literatur binding protein that phys
- Seite 266 und 267: Literatur Riddiford, L. M., Hiruma,
- Seite 268 und 269: Literatur Schüpbach, T. und Wiesch
- Seite 270 und 271: Literatur Tomoyasu, Y., Miller, S.
- Seite 272: Literatur Zhang, X. D. und Heyse, J