Literatur Falciani, F., Hausdorf, B., Schröder, R., Akam, M., Tautz, D., Denell, R. und Brown, S., 1996. Class 3 Hox genes in insects and the origin of zen. Proc Natl Acad Sci U S A. 93, 8479- 84. Finkelstein, R. und Perrimon, N., 1990. The orthodenticle gene is regulated by bicoid and torso and specifies Drosophila head development. Nature. 346, 485-8. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. und Mello, C. C., 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-11. Fleig, R. und Sander, K., 1986. Embryogenesis of the honeybee Apis melliferra L (Hymenoptera, Apidae) - an SEM Study. International Journal of Insect Morphology & Embryology. 15, 449-462. Foe, V. E. und Alberts, B. M., 1983. Studies of nuclear and cytoplasmic behaviour during the 5 mitotic cycles that precede gastrulation in Drosophila embryogenesis. Journal of Cell Science. 61, 31-70. Fonseca, R. N., Lynch, J. A. und Roth, S., 2009. Evolution of axis formation: mRNA localization, regulatory circuits and posterior specification in non-model arthropods. Curr Opin Genet Dev. 19, 404-11. Forbes, A. und Lehmann, R., 1998. Nanos and Pumilio have critical roles in the development and function of Drosophila germline stem cells. Development. 125, 679-90. Forrest, K. M. und Gavis, E. R., 2003. Live imaging of endogenous RNA reveals a diffusion and entrapment mechanism for nanos mRNA localization in Drosophila. Curr Biol. 13, 1159-68. Francischini, C. W. und Quaggio, R. B., 2009. Molecular characterization of Arabidopsis thaliana PUF proteins--binding specificity and target candidates. FEBS J. 276, 5456-70. Francke, W. und Dettner, K., Chemical signalling in beetles. Chemistry of Pheromones and Other Semiochemicals Ii, Vol. 240. Springer-Verlag Berlin, Berlin, 2005, pp. 85-166. Frasch, M., Hoey, T., Rushlow, C., Doyle, H. und Levine, M., 1987. Characterization and localization of the even-skipped protein of Drosophila. EMBO J. 6, 749-59. Frasch, M. und Levine, M., 1987. Complementary patterns of even-skipped and fushi tarazu expression involve their differential regulation by a common set of segmentation genes in Drosophila. Genes Dev. 1, 981-95. Frasch, M. und Nguyen, H. T., 1999. Genetic control of mesoderm patterning and differentiation during Drosophila embryogenesis. Advances in Developmental Biochemistry, Vol 5, 1999. 5, 1-47. Fraser, A. G., Kamath, R. S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. und Ahringer, J., 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature. 408, 325-30. Friedman, A. und Perrimon, N., 2006. A functional RNAi screen for regulators of receptor tyrosine kinase and ERK signalling. Nature. 444, 230-4. Frigerio, G., Burri, M., Bopp, D., Baumgartner, S. und Noll, M., 1986. Structure of the segmentation gene paired and the Drosophila PRD gene set as part of a gene network. Cell. 47, 735-46. Fujioka, M., Emi-Sarker, Y., Yusibova, G. L., Goto, T. und Jaynes, J. B., 1999. Analysis of an even-skipped rescue transgene reveals both composite and discrete neuronal and early blastoderm enhancers, and multi-stripe positioning by gap gene repressor gradients. Development. 126, 2527-38. Furriols, M. und Casanova, J., 2003. In and out of Torso RTK signalling. EMBO J. 22, 1947- 52. Gabbrielli, G., 1957. [Synergism of action between antibiotics & essential oils; synergic action of penicillin & essence of Pinus pumilio on Streptococcus pyogenes & Staphylococcus aureus.]. Gazz Med Ital. 116, 588-91. Gajewski, K., Wang, J., Molkentin, J. D., Chen, E. H., Olson, E. N. und Schulz, R. A., 2003. Requirement of the calcineurin subunit gene canB2 for indirect flight muscle formation in Drosophila. Proc Natl Acad Sci U S A. 100, 1040-5. 248
Literatur Galindo, M. I., Pueyo, J. I., Fouix, S., Bishop, S. A. und Couso, J. P., 2007. Peptides encoded by short ORFs control development and define a new eukaryotic gene family. PLoS Biol. 5, e106. Gamberi, C., Peterson, D. S., He, L. und Gottlieb, E., 2002. An anterior function for the Drosophila posterior determinant Pumilio. Development. 129, 2699-710. Gans, M., Audit, C. und Masson, M., 1975. Isolation and characterization of sex-linked female-sterile mutants in Drosophila melanogaster. Genetics. 81, 683-704. Gao, F. B., Brenman, J. E., Jan, L. Y. und Jan, Y. N., 1999. Genes regulating dendritic outgrowth, branching, and routing in Drosophila. Genes Dev. 13, 2549-61. Garcia-Fernandez, J., 2005. The genesis and evolution of homeobox gene clusters. Nat Rev Genet. 6, 881-92. Gaul, U., Seifert, E., Schuh, R. und Jäckle, H., 1987. Analysis of Kruppel protein distribution during early Drosophila development reveals posttranscriptional regulation. Cell. 50, 639-47. Gavis, E. R. und Lehmann, R., 1992. Localization of nanos RNA controls embryonic polarity. Cell. 71, 301-13. Gavis, E. R. und Lehmann, R., 1994. Translational regulation of nanos by RNA localization. Nature. 369, 315-8. Gerber, A. P., Luschnig, S., Krasnow, M. A., Brown, P. O. und Herschlag, D., 2006. Genome-wide identification of mRNAs associated with the translational regulator PUMILIO in Drosophila melanogaster. Proc Natl Acad Sci U S A. 103, 4487-92. Gergen, J. P. und Butler, B. A., 1988. Isolation of the Drosophila segmentation gene runt and analysis of its expression during embryogenesis. Genes Dev. 2, 1179-93. Gilboa, L. und Lehmann, R., 2004. Repression of primordial germ cell differentiation parallels germ line stem cell maintenance. Curr Biol. 14, 981-6. Goldstrohm, A. C., Hook, B. A., Seay, D. J. und Wickens, M., 2006. PUF proteins bind Pop2p to regulate messenger RNAs. Nat Struct Mol Biol. 13, 533-9. Goldstrohm, A. C., Seay, D. J., Hook, B. A. und Wickens, M., 2007. PUF protein-mediated deadenylation is catalyzed by Ccr4p. J Biol Chem. 282, 109-14. Goltsev, Y., Hsiong, W., Lanzaro, G. und Levine, M., 2004. Different combinations of gap repressors for common stripes in Anopheles and Drosophila embryos. Dev Biol. 275, 435-46. Gönczy, P., Echeverri, C., Oegema, K. et al., 2000. Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature. 408, 331-6. Gonzalez-Gaitan, M., Rothe, M., Wimmer, E. A., Taubert, H. und Jäckle, H., 1994. Redundant functions of the genes knirps and knirps-related for the establishment of anterior Drosophila head structures. Proc Natl Acad Sci U S A. 91, 8567-71. Gonzalez-Reyes, A., Elliott, H. und St Johnston, D., 1995. Polarization of both major body axes in Drosophila by gurken-torpedo signalling. Nature. 375, 654-8. Govind, S. und Steward, R., 1991. Dorsoventral pattern formation in Drosophila: signal transduction and nuclear targeting. Trends Genet. 7, 119-25. Grünfelder, C., Vom frisch abgelegten Ei zum Blastoderm: Untersuchungen zur Feinstruktur der frühen Embryogenese des Reismehlkäfers Tribolium confusum, PhD, Biology Department, Albert- Ludwigs-<strong>Universität</strong> Freiburg Gupta, Y. K., Lee, T. H., Edwards, T. A., Escalante, C. R., Kadyrova, L. Y., Wharton, R. P. und Aggarwal, A. K., 2009. Co-occupancy of two Pumilio molecules on a single hunchback NRE. RNA. 15, 1029-35. Gupta, Y. K., Nair, D. T., Wharton, R. P. und Aggarwal, A. K., 2008. Structures of human Pumilio with noncognate RNAs reveal molecular mechanisms for binding promiscuity. Structure. 16, 549-57. Gutjahr, T., Frei, E. und Noll, M., 1993. Complex regulation of early paired expression: initial activation by gap genes and pattern modulation by pair-rule genes. Development. 117, 609-23. 249
- Seite 1 und 2:
Die Funktion von Genen der posterio
- Seite 3:
Danke! Obwohl als letztes verfasst,
- Seite 6 und 7:
Inhaltsverzeichnis 2.4.1. Die Segme
- Seite 8 und 9:
Inhaltsverzeichnis 3.1.2. Die Auswe
- Seite 10 und 11:
Summary 2 Thus, I could show that a
- Seite 12 und 13:
Zusammenfassung praktischen Durchf
- Seite 14 und 15:
Abbildungsverzeichnis Abb. 24: Sche
- Seite 16 und 17:
Abkürzungen Abkürzungen 8 AS: Ami
- Seite 19 und 20:
Allgemeine Einleitung Allgemeine Ei
- Seite 21 und 22:
Allgemeine Einleitung Tiere, hervor
- Seite 23 und 24:
I. Kapitel: I. 1. Einleitung Die Fu
- Seite 25 und 26:
I. 1. Einleitung 3; Davis und Patel
- Seite 27 und 28:
I. 1. Einleitung 1.2. Drosophila me
- Seite 29 und 30:
I. 1. Einleitung Butler, 1988). Int
- Seite 31 und 32:
I. 1. Einleitung zur Phosphorylieru
- Seite 33 und 34:
I. 1. Einleitung Gene ist in Tribol
- Seite 35 und 36:
I. 1. Einleitung Die frühe Regulat
- Seite 37 und 38:
I. 1. Einleitung wahrscheinlich üb
- Seite 39 und 40:
I. 1. Einleitung wie in Vertebraten
- Seite 41 und 42:
I. 1. Einleitung und Wharton, 1999)
- Seite 43 und 44:
I. 1. Einleitung des nanos-Verlusts
- Seite 45 und 46:
I. 1. Einleitung Außerdem zeigen n
- Seite 47 und 48:
1.5. Ziele des ersten Kapitels der
- Seite 49 und 50:
2. Ergebnisse I. 2. Ergebnisse 2.1.
- Seite 51 und 52:
I. 2. Ergebnisse Abb. 6: Sequenzver
- Seite 53 und 54:
I. 2. Ergebnisse Domäne vermittelt
- Seite 55 und 56:
2.2.2. nanos-Expression ist nur in
- Seite 57 und 58:
I. 2. Ergebnisse 2.3. pRNAi für na
- Seite 59 und 60:
I. 2. Ergebnisse einerseits, dass d
- Seite 61 und 62:
I. 2. Ergebnisse des Kopfes. Außer
- Seite 63 und 64:
I. 2. Ergebnisse Doppel-RNAi in ver
- Seite 65 und 66:
I. 2. Ergebnisse 2.4. Frühembryona
- Seite 67 und 68:
I. 2. Ergebnisse nächst ist zu beo
- Seite 69 und 70:
I. 2. Ergebnisse 61
- Seite 71 und 72:
I. 2. Ergebnisse Domäne. Diese ble
- Seite 73 und 74:
I. 2. Ergebnisse 65
- Seite 75 und 76:
I. 2. Ergebnisse terminaler Zielgen
- Seite 77 und 78:
I. 2. Ergebnisse Tatsächlich fehle
- Seite 79 und 80:
I. 2. Ergebnisse Abb. 15: nos/pum-R
- Seite 81 und 82:
I. 2. Ergebnisse Expression auf die
- Seite 83 und 84:
I. 2. Ergebnisse 2.7. Die Beteiligu
- Seite 85 und 86:
2.7.1. Tribolium brain-tumor I. 2.
- Seite 87 und 88:
I. 2. Ergebnisse 2.7.3. brat-RNAi f
- Seite 89 und 90:
I. 2. Ergebnisse kulas somit interm
- Seite 91 und 92:
Abb. 19: brain-tumor-RNAi führt zu
- Seite 93 und 94:
I. 2. Ergebnisse Keimbahn in Verbin
- Seite 95 und 96:
I. 2. Ergebnisse 2.8.3. pumilio spi
- Seite 97 und 98:
I. 2. Ergebnisse Präpuppe, deren M
- Seite 99 und 100:
3. Diskussion I. 3. Diskussion 3.1.
- Seite 101 und 102:
I. 3. Diskussion mann, 1998; Asaoka
- Seite 103 und 104:
I. 3. Diskussion leider nicht gepr
- Seite 105 und 106:
I. 3. Diskussion Möglicherweise ve
- Seite 107 und 108:
I. 3. Diskussion Marques-Souza et a
- Seite 109 und 110:
I. 3. Diskussion der antennalen Seg
- Seite 111 und 112:
I. 3. Diskussion Effekt, der erst i
- Seite 113 und 114:
I. 3. Diskussion Netzwerk, das zur
- Seite 115 und 116:
I. 3. Diskussion gerufene Vernetzun
- Seite 117 und 118:
I. 3. Diskussion Natürlich gibt es
- Seite 119 und 120:
I. 3. Diskussion 3.4. Das Zusammens
- Seite 121 und 122:
I. 3. Diskussion sion als Substrat
- Seite 123 und 124:
I. 3. Diskussion ren gt-Domäne üb
- Seite 125 und 126:
I. 3. Diskussion Außerdem hat otd-
- Seite 127 und 128:
I. 3. Diskussion on eines von Fakto
- Seite 129 und 130:
I. 3. Diskussion jeweiligen ersten
- Seite 131 und 132:
4. Material und Methoden I. 4. Mate
- Seite 133 und 134:
4.2.1. in situ Hybridisierung I. 4.
- Seite 135 und 136:
I. 4. Material und Methoden ohne Bl
- Seite 137:
Tab. 6: Primer für dsRNA Matrize I
- Seite 140 und 141:
II. 1. Einleitung 132 In Anlehnung
- Seite 142 und 143:
II. 1. Einleitung Entwicklung. Dabe
- Seite 144 und 145:
II. 1. Einleitung 1.3. RNAi-Screens
- Seite 146 und 147:
II. 1. Einleitung Serie zu beobacht
- Seite 148 und 149:
II. 1. Einleitung 140 schen Fragest
- Seite 150 und 151:
II. 1. Einleitung Augen und im zent
- Seite 152 und 153:
II. 1. Einleitung 1.4.3. Die iBeetl
- Seite 154 und 155:
II. 1. Einleitung sophila wegen tec
- Seite 156 und 157:
II. 1. Einleitung 1.5. Ziele des zw
- Seite 158 und 159:
II. 2. Ergebnisse nale Musterbildun
- Seite 160 und 161:
II. 2. Ergebnisse 152 Im nächsten
- Seite 162 und 163:
II. 2. Ergebnisse bei 30°C inkubie
- Seite 164 und 165:
II. 2. Ergebnisse 1999a) 156 Auch d
- Seite 166 und 167:
II. 2. Ergebnisse lichst effektiv z
- Seite 168 und 169:
II. 2. Ergebnisse 160
- Seite 170 und 171:
II. 2. Ergebnisse 162
- Seite 172 und 173:
II. 2. Ergebnisse Abb. 29: Arbeitsp
- Seite 174 und 175:
II. 2. Ergebnisse Ergebnisse der Po
- Seite 176 und 177:
II. 2. Ergebnisse von RNAi-Effekten
- Seite 178 und 179:
II. 2. Ergebnisse 2.3. Es konnten f
- Seite 180 und 181:
II. 2. Ergebnisse Abb. 32: Zusammen
- Seite 182 und 183:
II. 2. Ergebnisse Abb. 33: Defekte
- Seite 184 und 185:
II. 2. Ergebnisse zu trennen. So k
- Seite 186 und 187:
II. 2. Ergebnisse 2.3.2. Defekte w
- Seite 188 und 189:
II. 2. Ergebnisse Abb. 35: Morpholo
- Seite 190 und 191:
II. 2. Ergebnisse diesen Phänotype
- Seite 192 und 193:
II. 2. Ergebnisse 184
- Seite 194 und 195:
II. 2. Ergebnisse Abb. 37: In adult
- Seite 196 und 197:
II. 2. Ergebnisse Abb. 38: Bisher u
- Seite 198 und 199:
II. 3. Diskussion des ersten Jahres
- Seite 200 und 201:
II. 3. Diskussion analysiert werden
- Seite 202 und 203:
II. 3. Diskussion Meinung, dass der
- Seite 204 und 205:
II. 3. Diskussion jeweils zu Beginn
- Seite 206 und 207: II. 3. Diskussion nach den gleichen
- Seite 208 und 209: II. 3. Diskussion in Tribolium, nic
- Seite 210 und 211: II. 3. Diskussion 1980). Bei der Ka
- Seite 212 und 213: II. 3. Diskussion phänotypische Hi
- Seite 214 und 215: II. 3. Diskussion 3.2.6. iBeetle ha
- Seite 216 und 217: II. 3. Diskussion Prozesse der Inse
- Seite 218 und 219: II. 4. Material und Methoden Phenol
- Seite 220 und 221: II. 4. Material und Methoden pigmen
- Seite 222 und 223: II. 4. Material und Methoden 214 Em
- Seite 224 und 225: II. 4. Material und Methoden bei de
- Seite 226 und 227: II. 4. Material und Methoden 218 Ti
- Seite 229 und 230: Allgemeine Diskussion Allgemeine Di
- Seite 231: Allgemeine Diskussion und Achsendet
- Seite 234 und 235: Anhang ACCCATCCGTACGGCTGCCGGGTCATTC
- Seite 236 und 237: Anhang 2. Ergänzende Ergebnisse zu
- Seite 238 und 239: Anhang 3. Zeitaufwand der iBeetle-A
- Seite 240 und 241: Anhang 5. Zusammenfassung der Ergeb
- Seite 242 und 243: 234 134 900 14 similar to D123 (cdc
- Seite 244 und 245: 236 77 1500 57 gene without homolog
- Seite 246 und 247: 238 43 1000 99 similar to Rab-prote
- Seite 248 und 249: Anhang gemischt embryonal letal von
- Seite 250 und 251: Literatur Literatur Abdel-Latief, M
- Seite 252 und 253: Literatur Bernstein, D., Hook, B.,
- Seite 254 und 255: Literatur Ciglar, L. und Furlong, E
- Seite 258 und 259: Literatur Gutjahr, T., Vanario-Alon
- Seite 260 und 261: Literatur Kiger, A. A., Baum, B., J
- Seite 262 und 263: Literatur Lin, H. und Spradling, A.
- Seite 264 und 265: Literatur binding protein that phys
- Seite 266 und 267: Literatur Riddiford, L. M., Hiruma,
- Seite 268 und 269: Literatur Schüpbach, T. und Wiesch
- Seite 270 und 271: Literatur Tomoyasu, Y., Miller, S.
- Seite 272: Literatur Zhang, X. D. und Heyse, J