Literatur Ciglar, L. und Furlong, E. E. M., 2009. Conservation and divergence in developmental networks: a view from Drosophila myogenesis. Current Opinion in Cell Biology. 21, 754- 760. Cinnamon, E., Gur-Wahnon, D., Helman, A., St Johnston, D., Jimenez, G. und Paroush, Z., 2004. Capicua integrates input from two maternal systems in Drosophila terminal patterning. EMBO J. 23, 4571-82. Collins, R. T. und Cohen, S. M., 2005. A genetic screen in Drosophila for identifying novel components of the hedgehog signaling pathway. Genetics. 170, 173-84. Copf, T., Schröder, R. und Averof, M., 2004. Ancestral role of caudal genes in axis elongation and segmentation. Proc Natl Acad Sci U S A. 101, 17711-5. Counce, S. J., The causal analysis of insect embryogenesis. In: Counce, S. J. and Waddington, C. H., Eds.), Developmental Systems: Insects, Vol. 2. Academic Press, London, New York, 1973. Crittenden, S. L., Bernstein, D. S., Bachorik, J. L., Thompson, B. E., Gallegos, M., Petcherski, A. G., Moulder, G., Barstead, R., Wickens, M. und Kimble, J., 2002. A conserved RNA-binding protein controls germline stem cells in Caenorhabditis elegans. Nature. 417, 660-3. Curtis, C. D., Brisson, J. A., DeCamillis, M. A., Shippy, T. D., Brown, S. J. und Denell, R. E., 2001. Molecular characterization of Cephalothorax, the Tribolium ortholog of Sex combs reduced. Genesis. 30, 12-20. Curtis, D., Apfeld, J. und Lehmann, R., 1995. nanos is an evolutionarily conserved organizer of anterior-posterior polarity. Development. 121, 1899-910. Curtis, D., Treiber, D. K., Tao, F., Zamore, P. D., Williamson, J. R. und Lehmann, R., 1997. A CCHC metal-binding domain in Nanos is essential for translational regulation. EMBO J. 16, 834-43. D'Errico, I., Gadaleta, G. und Saccone, C., 2004. Pseudogenes in metazoa: origin and features. Brief Funct Genomic Proteomic. 3, 157-67. Dahanukar, A., Walker, J. A. und Wharton, R. P., 1999. Smaug, a novel RNA-binding protein that operates a translational switch in Drosophila. Mol Cell. 4, 209-18. Dahanukar, A. und Wharton, R. P., 1996. The Nanos gradient in Drosophila embryos is generated by translational regulation. Genes Dev. 10, 2610-20. Damen, W. G., Hausdorf, M., Seyfarth, E. A. und Tautz, D., 1998. A conserved mode of head segmentation in arthropods revealed by the expression pattern of Hox genes in a spider. Proc Natl Acad Sci U S A. 95, 10665-70. DasGupta, R., Kaykas, A., Moon, R. T. und Perrimon, N., 2005. Functional genomic analysis of the Wnt-wingless signaling pathway. Science. 308, 826-33. Davis, G. K. und Patel, N. H., 2002. Short, long, and beyond: molecular and embryological approaches to insect segmentation. Annu Rev Entomol. 47, 669-99. Dearden, P. K., 2006. Germ cell development in the Honeybee (Apis mellifera); vasa and nanos expression. BMC Dev Biol. 6, 6. Dearden, P. K., Wilson, M. J., Sablan, L., Osborne, P. W., Havler, M., McNaughton, E., Kimura, K., Milshina, N. V., Hasselmann, M., Gempe, T., Schioett, M., Brown, S. J., Elsik, C. G., Holland, P. W., Kadowaki, T. und Beye, M., 2006. Patterns of conservation and change in honey bee developmental genes. Genome Res. 16, 1376-84. Denell, R., 2008. Establishment of tribolium as a genetic model system and its early contributions to evo-devo. Genetics. 180, 1779-86. Denell, R. und Shippy, T., 2001. Comparative insect developmental genetics: phenotypes without mutants. Bioessays. 23, 379-82. Deng, Y., Singer, R. H. und Gu, W., 2008. Translation of ASH1 mRNA is repressed by Puf6p-Fun12p/eIF5B interaction and released by CK2 phosphorylation. Genes Dev. 22, 1037-50. Deshpande, G., Calhoun, G., Jinks, T. M., Polydorides, A. D. und Schedl, P., 2005. Nanos downregulates transcription and modulates CTD phosphorylation in the soma of early Drosophila embryos. Mech Dev. 122, 645-57. 246
Literatur Deshpande, G., Calhoun, G., Yanowitz, J. L. und Schedl, P. D., 1999. Novel functions of nanos in downregulating mitosis and transcription during the development of the Drosophila germline. Cell. 99, 271-81. Dettner, K., 2003. Lehrbuch der Entomologie. Spektrum Akademischer Verlag, Heidelberg. Dietzl, G., Chen, D., Schnorrer, F., Su, K. C., Barinova, Y., Fellner, M., Gasser, B., Kinsey, K., Oppel, S., Scheiblauer, S., Couto, A., Marra, V., Keleman, K. und Dickson, B. J., 2007. A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature. 448, 151-6. Dill, K. K. und Seaver, E. C., 2008. Vasa and nanos are coexpressed in somatic and germ line tissue from early embryonic cleavage stages through adulthood in the polychaete Capitella sp. I. Dev Genes Evol. 218, 453-63. DiNardo, S., Kuner, J. M., Theis, J. und O'Farrell, P. H., 1985. Development of embryonic pattern in D. melanogaster as revealed by accumulation of the nuclear engrailed protein. Cell. 43, 59-69. DiNardo, S. und O'Farrell, P. H., 1987. Establishment and refinement of segmental pattern in the Drosophila embryo: spatial control of engrailed expression by pair-rule genes. Genes Dev. 1, 1212-25. Draper, B. W., McCallum, C. M. und Moens, C. B., 2007. nanos1 is required to maintain oocyte production in adult zebrafish. Dev Biol. 305, 589-98. Driever, W. und Nüsslein-Volhard, C., 1988a. A gradient of bicoid protein in Drosophila embryos. Cell. 54, 83-93. Driever, W. und Nüsslein-Volhard, C., 1988b. The bicoid protein determines position in the Drosophila embryo in a concentration-dependent manner. Cell. 54, 95-104. Driever, W. und Nüsslein-Volhard, C., 1989. The bicoid protein is a positive regulator of hunchback transcription in the early Drosophila embryo. Nature. 337, 138-43. Droll, D., Archer, S., Fenn, K., Delhi, P., Matthews, K. und Clayton, C., 2010. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation. FEBS Lett. Dubnau, J., Chiang, A. S., Grady, L., Barditch, J., Gossweiler, S., McNeil, J., Smith, P., Buldoc, F., Scott, R., Certa, U., Broger, C. und Tully, T., 2003. The staufen/pumilio pathway is involved in Drosophila long-term memory. Curr Biol. 13, 286-96. Dubnau, J. und Struhl, G., 1996. RNA recognition and translational regulation by a homeodomain protein. Nature. 379, 694-9. Duffy, J. B., Kania, M. A. und Gergen, J. P., 1991. Expression and function of the Drosophila gene runt in early stages of neural development. Development. 113, 1223-30. Eckert, C., Aranda, M., Wolff, C. und Tautz, D., 2004. Separable stripe enhancer elements for the pair-rule gene hairy in the beetle Tribolium. EMBO Rep. 5, 638-42. Edwards, T. A., Pyle, S. E., Wharton, R. P. und Aggarwal, A. K., 2001. Structure of Pumilio reveals similarity between RNA and peptide binding motifs. Cell. 105, 281-9. Eldon, E. D. und Pirrotta, V., 1991. Interactions of the Drosophila gap gene giant with maternal and zygotic pattern-forming genes. Development. 111, 367-78. Engsontia, P., Sanderson, A. P., Cobb, M., Walden, K. K., Robertson, H. M. und Brown, S., 2008. The red flour beetle's large nose: an expanded odorant receptor gene family in Tribolium castaneum. Insect Biochem Mol Biol. 38, 387-97. Enslee, E. C. und Riddiford, L. M., 1981. Blastokinesis in embryos of the bug, Pyrrhocoris apterus. A light and electron microscopic study 1. Normal blastokinesis. J Embryol Exp Morphol. 61, 35-49. Ephrussi, A., Dickinson, L. K. und Lehmann, R., 1991. Oskar organizes the germ plasm and directs localization of the posterior determinant nanos. Cell. 66, 37-50. Extavour, C. G., Pang, K., Matus, D. Q. und Martindale, M. Q., 2005. vasa and nanos expression patterns in a sea anemone and the evolution of bilaterian germ cell specification mechanisms. Evol Dev. 7, 201-15. Farzana, L. und Brown, S. J., 2008. Hedgehog signaling pathway function conserved in Tribolium segmentation. Dev Genes Evol. 218, 181-92. 247
- Seite 1 und 2:
Die Funktion von Genen der posterio
- Seite 3:
Danke! Obwohl als letztes verfasst,
- Seite 6 und 7:
Inhaltsverzeichnis 2.4.1. Die Segme
- Seite 8 und 9:
Inhaltsverzeichnis 3.1.2. Die Auswe
- Seite 10 und 11:
Summary 2 Thus, I could show that a
- Seite 12 und 13:
Zusammenfassung praktischen Durchf
- Seite 14 und 15:
Abbildungsverzeichnis Abb. 24: Sche
- Seite 16 und 17:
Abkürzungen Abkürzungen 8 AS: Ami
- Seite 19 und 20:
Allgemeine Einleitung Allgemeine Ei
- Seite 21 und 22:
Allgemeine Einleitung Tiere, hervor
- Seite 23 und 24:
I. Kapitel: I. 1. Einleitung Die Fu
- Seite 25 und 26:
I. 1. Einleitung 3; Davis und Patel
- Seite 27 und 28:
I. 1. Einleitung 1.2. Drosophila me
- Seite 29 und 30:
I. 1. Einleitung Butler, 1988). Int
- Seite 31 und 32:
I. 1. Einleitung zur Phosphorylieru
- Seite 33 und 34:
I. 1. Einleitung Gene ist in Tribol
- Seite 35 und 36:
I. 1. Einleitung Die frühe Regulat
- Seite 37 und 38:
I. 1. Einleitung wahrscheinlich üb
- Seite 39 und 40:
I. 1. Einleitung wie in Vertebraten
- Seite 41 und 42:
I. 1. Einleitung und Wharton, 1999)
- Seite 43 und 44:
I. 1. Einleitung des nanos-Verlusts
- Seite 45 und 46:
I. 1. Einleitung Außerdem zeigen n
- Seite 47 und 48:
1.5. Ziele des ersten Kapitels der
- Seite 49 und 50:
2. Ergebnisse I. 2. Ergebnisse 2.1.
- Seite 51 und 52:
I. 2. Ergebnisse Abb. 6: Sequenzver
- Seite 53 und 54:
I. 2. Ergebnisse Domäne vermittelt
- Seite 55 und 56:
2.2.2. nanos-Expression ist nur in
- Seite 57 und 58:
I. 2. Ergebnisse 2.3. pRNAi für na
- Seite 59 und 60:
I. 2. Ergebnisse einerseits, dass d
- Seite 61 und 62:
I. 2. Ergebnisse des Kopfes. Außer
- Seite 63 und 64:
I. 2. Ergebnisse Doppel-RNAi in ver
- Seite 65 und 66:
I. 2. Ergebnisse 2.4. Frühembryona
- Seite 67 und 68:
I. 2. Ergebnisse nächst ist zu beo
- Seite 69 und 70:
I. 2. Ergebnisse 61
- Seite 71 und 72:
I. 2. Ergebnisse Domäne. Diese ble
- Seite 73 und 74:
I. 2. Ergebnisse 65
- Seite 75 und 76:
I. 2. Ergebnisse terminaler Zielgen
- Seite 77 und 78:
I. 2. Ergebnisse Tatsächlich fehle
- Seite 79 und 80:
I. 2. Ergebnisse Abb. 15: nos/pum-R
- Seite 81 und 82:
I. 2. Ergebnisse Expression auf die
- Seite 83 und 84:
I. 2. Ergebnisse 2.7. Die Beteiligu
- Seite 85 und 86:
2.7.1. Tribolium brain-tumor I. 2.
- Seite 87 und 88:
I. 2. Ergebnisse 2.7.3. brat-RNAi f
- Seite 89 und 90:
I. 2. Ergebnisse kulas somit interm
- Seite 91 und 92:
Abb. 19: brain-tumor-RNAi führt zu
- Seite 93 und 94:
I. 2. Ergebnisse Keimbahn in Verbin
- Seite 95 und 96:
I. 2. Ergebnisse 2.8.3. pumilio spi
- Seite 97 und 98:
I. 2. Ergebnisse Präpuppe, deren M
- Seite 99 und 100:
3. Diskussion I. 3. Diskussion 3.1.
- Seite 101 und 102:
I. 3. Diskussion mann, 1998; Asaoka
- Seite 103 und 104:
I. 3. Diskussion leider nicht gepr
- Seite 105 und 106:
I. 3. Diskussion Möglicherweise ve
- Seite 107 und 108:
I. 3. Diskussion Marques-Souza et a
- Seite 109 und 110:
I. 3. Diskussion der antennalen Seg
- Seite 111 und 112:
I. 3. Diskussion Effekt, der erst i
- Seite 113 und 114:
I. 3. Diskussion Netzwerk, das zur
- Seite 115 und 116:
I. 3. Diskussion gerufene Vernetzun
- Seite 117 und 118:
I. 3. Diskussion Natürlich gibt es
- Seite 119 und 120:
I. 3. Diskussion 3.4. Das Zusammens
- Seite 121 und 122:
I. 3. Diskussion sion als Substrat
- Seite 123 und 124:
I. 3. Diskussion ren gt-Domäne üb
- Seite 125 und 126:
I. 3. Diskussion Außerdem hat otd-
- Seite 127 und 128:
I. 3. Diskussion on eines von Fakto
- Seite 129 und 130:
I. 3. Diskussion jeweiligen ersten
- Seite 131 und 132:
4. Material und Methoden I. 4. Mate
- Seite 133 und 134:
4.2.1. in situ Hybridisierung I. 4.
- Seite 135 und 136:
I. 4. Material und Methoden ohne Bl
- Seite 137:
Tab. 6: Primer für dsRNA Matrize I
- Seite 140 und 141:
II. 1. Einleitung 132 In Anlehnung
- Seite 142 und 143:
II. 1. Einleitung Entwicklung. Dabe
- Seite 144 und 145:
II. 1. Einleitung 1.3. RNAi-Screens
- Seite 146 und 147:
II. 1. Einleitung Serie zu beobacht
- Seite 148 und 149:
II. 1. Einleitung 140 schen Fragest
- Seite 150 und 151:
II. 1. Einleitung Augen und im zent
- Seite 152 und 153:
II. 1. Einleitung 1.4.3. Die iBeetl
- Seite 154 und 155:
II. 1. Einleitung sophila wegen tec
- Seite 156 und 157:
II. 1. Einleitung 1.5. Ziele des zw
- Seite 158 und 159:
II. 2. Ergebnisse nale Musterbildun
- Seite 160 und 161:
II. 2. Ergebnisse 152 Im nächsten
- Seite 162 und 163:
II. 2. Ergebnisse bei 30°C inkubie
- Seite 164 und 165:
II. 2. Ergebnisse 1999a) 156 Auch d
- Seite 166 und 167:
II. 2. Ergebnisse lichst effektiv z
- Seite 168 und 169:
II. 2. Ergebnisse 160
- Seite 170 und 171:
II. 2. Ergebnisse 162
- Seite 172 und 173:
II. 2. Ergebnisse Abb. 29: Arbeitsp
- Seite 174 und 175:
II. 2. Ergebnisse Ergebnisse der Po
- Seite 176 und 177:
II. 2. Ergebnisse von RNAi-Effekten
- Seite 178 und 179:
II. 2. Ergebnisse 2.3. Es konnten f
- Seite 180 und 181:
II. 2. Ergebnisse Abb. 32: Zusammen
- Seite 182 und 183:
II. 2. Ergebnisse Abb. 33: Defekte
- Seite 184 und 185:
II. 2. Ergebnisse zu trennen. So k
- Seite 186 und 187:
II. 2. Ergebnisse 2.3.2. Defekte w
- Seite 188 und 189:
II. 2. Ergebnisse Abb. 35: Morpholo
- Seite 190 und 191:
II. 2. Ergebnisse diesen Phänotype
- Seite 192 und 193:
II. 2. Ergebnisse 184
- Seite 194 und 195:
II. 2. Ergebnisse Abb. 37: In adult
- Seite 196 und 197:
II. 2. Ergebnisse Abb. 38: Bisher u
- Seite 198 und 199:
II. 3. Diskussion des ersten Jahres
- Seite 200 und 201:
II. 3. Diskussion analysiert werden
- Seite 202 und 203:
II. 3. Diskussion Meinung, dass der
- Seite 204 und 205: II. 3. Diskussion jeweils zu Beginn
- Seite 206 und 207: II. 3. Diskussion nach den gleichen
- Seite 208 und 209: II. 3. Diskussion in Tribolium, nic
- Seite 210 und 211: II. 3. Diskussion 1980). Bei der Ka
- Seite 212 und 213: II. 3. Diskussion phänotypische Hi
- Seite 214 und 215: II. 3. Diskussion 3.2.6. iBeetle ha
- Seite 216 und 217: II. 3. Diskussion Prozesse der Inse
- Seite 218 und 219: II. 4. Material und Methoden Phenol
- Seite 220 und 221: II. 4. Material und Methoden pigmen
- Seite 222 und 223: II. 4. Material und Methoden 214 Em
- Seite 224 und 225: II. 4. Material und Methoden bei de
- Seite 226 und 227: II. 4. Material und Methoden 218 Ti
- Seite 229 und 230: Allgemeine Diskussion Allgemeine Di
- Seite 231: Allgemeine Diskussion und Achsendet
- Seite 234 und 235: Anhang ACCCATCCGTACGGCTGCCGGGTCATTC
- Seite 236 und 237: Anhang 2. Ergänzende Ergebnisse zu
- Seite 238 und 239: Anhang 3. Zeitaufwand der iBeetle-A
- Seite 240 und 241: Anhang 5. Zusammenfassung der Ergeb
- Seite 242 und 243: 234 134 900 14 similar to D123 (cdc
- Seite 244 und 245: 236 77 1500 57 gene without homolog
- Seite 246 und 247: 238 43 1000 99 similar to Rab-prote
- Seite 248 und 249: Anhang gemischt embryonal letal von
- Seite 250 und 251: Literatur Literatur Abdel-Latief, M
- Seite 252 und 253: Literatur Bernstein, D., Hook, B.,
- Seite 256 und 257: Literatur Falciani, F., Hausdorf, B
- Seite 258 und 259: Literatur Gutjahr, T., Vanario-Alon
- Seite 260 und 261: Literatur Kiger, A. A., Baum, B., J
- Seite 262 und 263: Literatur Lin, H. und Spradling, A.
- Seite 264 und 265: Literatur binding protein that phys
- Seite 266 und 267: Literatur Riddiford, L. M., Hiruma,
- Seite 268 und 269: Literatur Schüpbach, T. und Wiesch
- Seite 270 und 271: Literatur Tomoyasu, Y., Miller, S.
- Seite 272: Literatur Zhang, X. D. und Heyse, J